Mutants (Isolated)

tm4263

Allele Nametm4263
Sequence NameC08B11.3
CGC Nameswsn-7
Worm BaseAllele Name tm4263
CGC Name swsn-7
Sequence C08B11.3
PhenotypeLet or Ste.
Mutation site10304/10305-11611/11612 (1307 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(6527..7279, 7328..7643, 7694..8475, 8854..8982, 9071..9239, 9313..10469, 10524..10903, 10948..11634))
Map position0.65
Balancer
Map position of balancer
Sequence of primersIntRev:CCATATCGTTTTGTAGCGCA,IntFwd:AGTAGACATTGCGGGTTCGA,ExtRev:TATGTGCATTGCTCCGGTTC,ExtFwd:CGCATAAAGCTCCCCTCGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Flibotte S, Kim BR, Van de Laar E, Brown L, Moghal N.
The SWI/SNF chromatin remodeling complex exerts both negative and positive control over LET-23/EGFR-dependent vulval induction in Caenorhabditis elegans.
Dev. Biol. 2016 415(1) 46-63 
[ PubMed ID = 27207389 ] [ RRC reference ]

Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]