Mutants (Isolated)

tm4263

Allele Nametm4263
Sequence NameC08B11.3
CGC Nameswsn-7
Worm BaseAllele Name tm4263
CGC Name swsn-7
Sequence C08B11.3
PhenotypeLet or Ste.
Mutation site10304/10305-11611/11612 (1307 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(6527..7279, 7328..7643, 7694..8475, 8854..8982, 9071..9239, 9313..10469, 10524..10903, 10948..11634))
Map position0.65
Balancer
Map position of balancer
Sequence of primersIntRev:CCATATCGTTTTGTAGCGCA,IntFwd:AGTAGACATTGCGGGTTCGA,ExtRev:TATGTGCATTGCTCCGGTTC,ExtFwd:CGCATAAAGCTCCCCTCGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Bowman R, Balukoff N, Clemons A, Koury E, Ford T, Baxi K, Egydio de Carvalho C, Smolikove S.
Akirin Is Required for Muscle Function and Acts Through the TGF-β Sma/Mab Signaling Pathway in Caenorhabditis elegans Development.
G3 (Bethesda) 2020 10(1) 387-400 
[ PubMed ID = 31767636 ] [ RRC reference ]

Flibotte S, Kim BR, Van de Laar E, Brown L, Moghal N.
The SWI/SNF chromatin remodeling complex exerts both negative and positive control over LET-23/EGFR-dependent vulval induction in Caenorhabditis elegans.
Dev Biol 2016 415(1) 46-63 
[ PubMed ID = 27207389 ] [ RRC reference ]

Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]