Mutants (Isolated)

tm4259

Allele Nametm4259
Sequence NameF52D2.4
CGC Namegei-12
Worm BaseAllele Name tm4259
CGC Name gei-12
Sequence F52D2.4
Phenotypehomozygous viable.
Mutation site40176/40177-ATGCT-40803/40804 (627 bp deletion + 5 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(38393..38718, 38767..39056, 39188..39322, 39371..39517, 39564..39674, 39721..41242, 41288..41345))
Map position-17.16
Balancer
Map position of balancer
Sequence of primersIntRev:GCGGTCTGCCAAACTCGAGA,IntFwd:CTTGCTGGATGATGTCAGAC,ExtRev:AACCTTACCCAAGCGGTCTG,ExtFwd:AACCACGCCAAGTGACTTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee CS, Putnam A, Lu T, He S, Ouyang JPT, Seydoux G.
Recruitment of mRNAs to P granules by condensation with intrinsically-disordered proteins.
Elife 2020 9  
[ PubMed ID = 31975687 ] [ RRC reference ]

Dodson AE, Kennedy S.
Germ Granules Coordinate RNA-Based Epigenetic Inheritance Pathways.
Dev. Cell 2019 50(6) 704-715.e4 
[ PubMed ID = 31402284 ] [ RRC reference ]

Lev I, Toker IA, Mor Y, Nitzan A, Weintraub G, Antonova O, Bhonkar O, Ben Shushan I, Seroussi U, Claycomb JM, Anava S, Gingold H, Zaidel-Bar R, Rechavi O.
Germ Granules Govern Small RNA Inheritance.
Curr. Biol. 2019 29(17) 2880-2891.e4 
[ PubMed ID = 31378614 ] [ RRC reference ]

Wan G, Fields BD, Spracklin G, Shukla A, Phillips CM, Kennedy S.
Spatiotemporal regulation of liquid-like condensates in epigenetic inheritance.
Nature 2018 557(7707) 679-683 
[ PubMed ID = 29769721 ] [ RRC reference ]

Chen JX, Cipriani PG, Mecenas D, Polanowska J, Piano F, Gunsalus KC, Selbach M.
In Vivo Interaction Proteomics in Caenorhabditis elegans Embryos Provides New Insights into P Granule Dynamics.
Mol. Cell Proteomics 2016 15(5) 1642-57 
[ PubMed ID = 26912668 ] [ RRC reference ]