Mutants (Isolated)

tm4255

Allele Nametm4255
Sequence NameY104H12BR.1
CGC Nameplst-1
Worm BaseAllele Name tm4255
CGC Name plst-1
Sequence Y104H12BR.1
Phenotypehomozygous viable.
Mutation site3985/3986-4353/4354 (368 bp deletion)
ChromosomeIV
Putative gene structurejoin(2146..2278, 3936..4312, 5193..5309)
Map position-20.56
Balancer
Map position of balancer
Sequence of primersExtFwd:CGCAAAAGAGCTCAGCTTGC,IntFwd:CGTTACAGATATCTACGACG,ExtRev:CCTTGCTTCATATCGGGAAG,IntRev:GTCACGAGCCATTAGACATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ding WY, Ong HT, Hara Y, Wongsantichon J, Toyama Y, Robinson RC, Nédélec F, Zaidel-Bar R.
Plastin increases cortical connectivity to facilitate robust polarization and timely cytokinesis.
J. Cell Biol. 2017 216(5) 1371-1386 
[ PubMed ID = 28400443 ] [ RRC reference ]

Dimitriadi M, Sleigh JN, Walker A, Chang HC, Sen A, Kalloo G, Harris J, Barsby T, Walsh MB, Satterlee JS, Li C, Van Vactor D, Artavanis-Tsakonas S, Hart AC.
Conserved genes act as modifiers of invertebrate SMN loss of function defects.
PLoS Genet. 2010 6(10) e1001172 
[ PubMed ID = 21124729 ] [ RRC reference ]