Home > Mutants (Isolated) > tm4255

Mutants (Isolated)

Allele Name		tm4255
Allele Type		Normal
Sequence Name		Y104H12BR.1
Gene Name		plst-1
Worm Base	Allele Name	tm4255
	Gene Name	plst-1
	Sequence	Y104H12BR.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3985/3986-4353/4354 (368 bp deletion)
Chromosome		IV
Putative gene structure		join(2146..2278, 3936..4312, 5193..5309)
Map position		-20.56
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CGCAAAAGAGCTCAGCTTGC,IntFwd:CGTTACAGATATCTACGACG,ExtRev:CCTTGCTTCATATCGGGAAG,IntRev:GTCACGAGCCATTAGACATG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Leite J, Chan FY, Osório DS, Saramago J, Sobral AF, Silva AM, Gassmann R, Carvalho AX. Equatorial Non-muscle Myosin II and Plastin Cooperate to Align and Compact F-actin Bundles in the Cytokinetic Ring. Front Cell Dev Biol 2020 8 573393  [ PubMed ID = 33102479 ] [ RRC reference ] Geisler F, Coch RA, Richardson C, Goldberg M, Bevilacqua C, Prevedel R, Leube RE. Intestinal intermediate filament polypeptides in C. elegans: Common and isotype-specific contributions to intestinal ultrastructure and function. Sci Rep 2020 10(1) 3142  [ PubMed ID = 32081918 ] [ RRC reference ] Priti A, Ong HT, Toyama Y, Padmanabhan A, Dasgupta S, Krajnc M, Zaidel-Bar R. Syncytial germline architecture is actively maintained by contraction of an internal actomyosin corset. Nat Commun 2018 9(1) 4694  [ PubMed ID = 30410005 ] [ RRC reference ] Gallotta I, Mazzarella N, Donato A, Esposito A, Chaplin JC, Castro S, Zampi G, Battaglia GS, Hilliard MA, Bazzicalupo P, Di Schiavi E. Neuron-specific knock-down of SMN1 causes neuron degeneration and death through an apoptotic mechanism. Hum Mol Genet 2016 25(12) 2564-2577  [ PubMed ID = 27260405 ] [ RRC reference ] Ding WY, Ong HT, Hara Y, Wongsantichon J, Toyama Y, Robinson RC, Nédélec F, Zaidel-Bar R. Plastin increases cortical connectivity to facilitate robust polarization and timely cytokinesis. J Cell Biol 2017 216(5) 1371-1386  [ PubMed ID = 28400443 ] [ RRC reference ] Dimitriadi M, Sleigh JN, Walker A, Chang HC, Sen A, Kalloo G, Harris J, Barsby T, Walsh MB, Satterlee JS, Li C, Van Vactor D, Artavanis-Tsakonas S, Hart AC. Conserved genes act as modifiers of invertebrate SMN loss of function defects. PLoS Genet 2010 6(10) e1001172  [ PubMed ID = 21124729 ] [ RRC reference ]