Mutants (Isolated)

tm4248

Allele Nametm4248
Sequence NameK02F3.4
CGC Namezip-2
Worm BaseAllele Name tm4248
CGC Name zip-2
Sequence K02F3.4
Phenotypehomozygous viable. Dr. J. Kaplan: non-Egl, non-Dpy, non-Sma.
Mutation site12299/12300-12521/12522 (222 bp deletion)
ChromosomeIII
Putative gene structurejoin(11760..11768, 11821..12136, 12193..12513, 12628..12908)
Map position-25.78
Balancer
Map position of balancer
Sequence of primersExtRev:TAGTCCTCGACTTGAGTCTC,IntRev:TTCGCTTCTCTAGACGCTCT,ExtFwd:CAGTGTTGCTTCATGGACGA,IntFwd:CCAAGTATGGAGCCGGTTAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Reddy KC, Dunbar TL, Nargund AM, Haynes CM, Troemel ER.
The C. elegans CCAAT-Enhancer-Binding Protein Gamma Is Required for Surveillance Immunity.
Cell Rep 2016 14(7) 1581-1589 
[ PubMed ID = 26876169 ] [ RRC reference ]

McEwan DL, Feinbaum RL, Stroustrup N, Haas W, Conery AL, Anselmo A, Sadreyev R, Ausubel FM.
Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.
BMC Biol 2016 14(1) 105 
[ PubMed ID = 27927200 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet 2017 13(6) e1006876 
[ PubMed ID = 28662060 ] [ RRC reference ]

McEwan DL, Kirienko NV, Ausubel FM.
Host translational inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an immune response in Caenorhabditis elegans.
Cell Host Microbe 2012 11(4) 364-74 
[ PubMed ID = 22520464 ] [ RRC reference ]

Dunbar TL, Yan Z, Balla KM, Smelkinson MG, Troemel ER.
C. elegans detects pathogen-induced translational inhibition to activate immune signaling.
Cell Host Microbe 2012 11(4) 375-86 
[ PubMed ID = 22520465 ] [ RRC reference ]

Pellegrino MW, Nargund AM, Kirienko NV, Gillis R, Fiorese CJ, Haynes CM.
Mitochondrial UPR-regulated innate immunity provides resistance to pathogen infection.
Nature 2014 516(7531) 414-7 
[ PubMed ID = 25274306 ] [ RRC reference ]

Kirienko NV, Ausubel FM, Ruvkun G.
Mitophagy confers resistance to siderophore-mediated killing by Pseudomonas aeruginosa.
Proc Natl Acad Sci U S A 2015 112(6) 1821-6 
[ PubMed ID = 25624506 ] [ RRC reference ]