Mutants (Isolated)

tm4221

Allele Nametm4221
Allele TypeBalanced
Sequence NameR01B10.6
Gene NameR01B10.6
Worm BaseAllele Name tm4221
Gene Name R01B10.6
Sequence R01B10.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11109/11110-11408/11409 (299 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(10453..10734, 11205..11354, 11400..11582, 11639..11759, 12062..12150))
Map position-0.37
BalancernT1
Map position of balancer
Sequence of primersExtFwd:AGTCACGATTAACTCGGCTT,IntFwd:TCCCTGGATGCCGGATGGAA,ExtRev:GGACCTGCTTTCATGGTAAC,IntRev:CCGTGAATATGTGGCCGTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Xie K, Liu Y, Li X, Zhang H, Zhang S, Mak HY, Liu P.
Dietary S. maltophilia induces supersized lipid droplets by enhancing lipogenesis and ER-LD contacts in C. elegans.
Gut Microbes 2022 14(1) 2013762 
[ PubMed ID = 35112996 ] [ RRC reference ]

Mosquera JV, Bacher MC, Priess JR.
Nuclear lipid droplets and nuclear damage in Caenorhabditis elegans.
PLoS Genet 2021 17(6) e1009602 
[ PubMed ID = 34133414 ] [ RRC reference ]

Cao Z, Hao Y, Fung CW, Lee YY, Wang P, Li X, Xie K, Lam WJ, Qiu Y, Tang BZ, Shui G, Liu P, Qu J, Kang BH, Mak HY.
Dietary fatty acids promote lipid droplet diversity through seipin enrichment in an ER subdomain.
Nat Commun 2019 10(1) 2902 
[ PubMed ID = 31263173 ] [ RRC reference ]