Mutants (Isolated)

tm421

Allele Nametm421
Sequence NameC05H8.1
CGC Nameckk-1
Worm BaseAllele Name tm421
CGC Name ckk-1
Sequence C05H8.1
Phenotypehomozygous viableDr. M. Hagiwara: EMBO Rep. 3, 962-966 (2002). Dr. P. Sengupta: defective chemosensation.
Mutation site9236/9237-9779/9780 (543 bp deletion)
ChromosomeIII
Putative gene structurejoin(7971..8057, 8337..8573, 8761..8908, 9099..9172, 9252..9434, 9494..9838)
Map position-1.47
Balancer
Map position of balancer
Sequence of primersExtFwd:GGGATATTGAGAGGATGAAG,ExtRev:TGGCGGTACATATGTCGGAT,IntRev:CCTTCACTGAGCTGCTCTTC,IntFwd:CCCCGCGTAAAACTGAAAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kimura Y, Corcoran EE, Eto K, Gengyo-Ando K, Muramatsu MA, Kobayashi R, Freedman JH, Mitani S, Hagiwara M, Means AR, Tokumitsu H.
A CaMK cascade activates CRE-mediated transcription in neurons of Caenorhabditis elegans.
EMBO Rep. 2002 3(10) 962-6 
[ PubMed ID = 12231504 ] [ RRC reference ]