Mutants (Isolated)

tm4200

Allele Nametm4200
Sequence NameF16D3.1
CGC Nametba-5
Worm BaseAllele Name tm4200
CGC Name tba-5
Sequence F16D3.1
Phenotypehomozygous viable. Dr. J.M. Scholey: non-Dyf.
Mutation site3813/3814-4104/4105 (291 bp deletion)
ChromosomeI
Putative gene structurejoin(888..1118, 2663..2969, 3375..3604, 3654..3718, 4000..4259, 5056..5306)
Map position2.75
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTCCTCAGATCAGTACATG,IntRev:CACGTCGCGAATTAACTATG,IntFwd:CTAGAGAAAGACCTCGCATG,ExtRev:ACTCATGCACGCTTTACATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Scholey JM.
Kinesin-2 motors transport IFT-particles, dyneins and tubulin subunits to the tips of Caenorhabditis elegans sensory cilia: relevance to vision research?
Vision Res 2012 75 44-52 
[ PubMed ID = 22772029 ] [ RRC reference ]

Maurya AK, Rogers T, Sengupta P.
A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans.
Curr Biol 2019 29(8) 1286-1300.e4 
[ PubMed ID = 30955935 ] [ RRC reference ]

Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM.
Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments.
Nat Cell Biol 2011 13(7) 790-8 
[ PubMed ID = 21642982 ] [ RRC reference ]