Home > Mutants (Isolated) > tm4200

Mutants (Isolated)

Allele Name		tm4200
Allele Type		Normal
Sequence Name		F16D3.1
Gene Name		tba-5
Worm Base	Allele Name	tm4200
	Gene Name	tba-5
	Sequence	F16D3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. J.M. Scholey: non-Dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3813/3814-4104/4105 (291 bp deletion)
Chromosome		I
Putative gene structure		join(888..1118, 2663..2969, 3375..3604, 3654..3718, 4000..4259, 5056..5306)
Map position		2.75
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GCTCCTCAGATCAGTACATG,IntRev:CACGTCGCGAATTAACTATG,IntFwd:CTAGAGAAAGACCTCGCATG,ExtRev:ACTCATGCACGCTTTACATG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Maurya AK, Rogers T, Sengupta P. A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans. Curr Biol 2019 29(8) 1286-1300.e4  [ PubMed ID = 30955935 ] [ RRC reference ] Scholey JM. Kinesin-2 motors transport IFT-particles, dyneins and tubulin subunits to the tips of Caenorhabditis elegans sensory cilia: relevance to vision research? Vision Res 2012 75 44-52  [ PubMed ID = 22772029 ] [ RRC reference ] Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM. Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments. Nat Cell Biol 2011 13(7) 790-8  [ PubMed ID = 21642982 ] [ RRC reference ]