Mutants (Isolated)

tm4189

Allele Nametm4189
Sequence NameC55B7.10
CGC NameC55B7.10
Worm BaseAllele Name tm4189
CGC Name C55B7.10
Sequence C55B7.10
Phenotypehomozygous viable.
Mutation site20775/20776-G-20907/20908 (132 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(20769..20941, 20983..21193))
Map position1.18
Balancer
Map position of balancer
Sequence of primersIntRev:GGGGTCAAGTCGAATCGCCA,ExtFwd:AATGGTTTTGTGCCGAGCAG,IntFwd:TGCCGAGCAGTTCTGTCTCA,ExtRev:TTCCCGTGATGTGAAGCCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann Neurol 2013 74(1) 39-52 
[ PubMed ID = 23424178 ] [ RRC reference ]