Mutants (Isolated)

tm4182

Allele Nametm4182
Sequence NameY42A5A.4
CGC NameY42A5A.4
Worm BaseAllele Name tm4182
CGC Name Y42A5A.4
Sequence Y42A5A.4
Phenotypehomozygous viable.
Mutation site19180/19181-20030/20031 (850 bp deletion)
ChromosomeV
Putative gene structurejoin(18298..18465, 18882..19003, 19046..19209, 19332..19529, 19579..19718, 19760..19888, 19935..20075)
Map position2.95
Balancer
Map position of balancer
Sequence of primersExtFwd:GACATATCACCTGCGCTCAT,IntFwd:CCGTATCTTTACAGCAACTG,ExtRev:TCACTGGGTCTCCCCACGAT,IntRev:CCGGCATATTGATTCATGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Canning P, Park K, Gonçalves J, Li C, Howard CJ, Sharpe TD, Holt LJ, Pelletier L, Bullock AN, Leroux MR.
CDKL Family Kinases Have Evolved Distinct Structural Features and Ciliary Function.
Cell Rep 2018 22(4) 885-894 
[ PubMed ID = 29420175 ] [ RRC reference ]

Li C, Jensen VL, Park K, Kennedy J, Garcia-Gonzalo FR, Romani M, De Mori R, Bruel AL, Gaillard D, Doray B, Lopez E, Rivière JB, Faivre L, Thauvin-Robinet C, Reiter JF, Blacque OE, Valente EM, Leroux MR.
MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone.
PLoS Biol 2016 14(3) e1002416 
[ PubMed ID = 26982032 ] [ RRC reference ]