Mutants (Isolated)

tm4178

Allele Nametm4178
Sequence NameZK1236.1
CGC NameZK1236.1
Worm BaseAllele Name tm4178
CGC Name ZK1236.1
Sequence ZK1236.1
Phenotypehomozygous viable.
Mutation site16407/16408-T-16670/16671 (263 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(16448..16672, 16716..16844, 16895..17059, 17108..17256, 17312..18251, 18301..18630)
Map position-0.26
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGCCCCTTTTCTTGGATTG,ExtRev:GATCGATGTGATCTCTCCTC,IntFwd:GATCCACATTTTCCCCAGAG,IntRev:GCACAATCCATTGACAGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yang F, Gao Y, Li Z, Chen L, Xia Z, Xu T, Qin Y.
Mitochondrial EF4 links respiratory dysfunction and cytoplasmic translation in Caenorhabditis elegans.
Biochim. Biophys. Acta 2014 1837(10) 1674-83 
[ PubMed ID = 24837196 ] [ RRC reference ]