Mutants (Isolated)

tm4171

Allele Nametm4171
Sequence NameY49A3A.5
CGC Namecyn-1
Worm BaseAllele Name tm4171
CGC Name cyn-1
Sequence Y49A3A.5
Phenotypehomozygous viable.
Mutation site7884/7885-8258/8259 (374 bp deletion)
ChromosomeV
Putative gene structurejoin(7954..8217,8281..8595)
Map position6.28
Balancer
Map position of balancer
Sequence of primersIntRev:TGTGCGAAGACGTGTGAATA,ExtRev:TTGTGCACACATAGAGCCTA,IntFwd:GCGTTTTTCGCGTGCACGAG,ExtFwd:ACATTCTAAACCACGCGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Geng X, Harry BL, Zhou Q, Skeen-Gaar RR, Ge X, Lee ES, Mitani S, Xue D.
Hepatitis B virus X protein targets the Bcl-2 protein CED-9 to induce intracellular Ca2+ increase and cell death in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(45) 18465-70 
[ PubMed ID = 23091037 ] [ RRC reference ]