Mutants (Isolated)

tm415

Allele Nametm415
Sequence NameC26C6.1
CGC Namepbrm-1
Worm BaseAllele Name tm415
CGC Name pbrm-1
Sequence C26C6.1
Phenotypehomozygous viable. Dr. J. Ahringer: low percentage Pvl and Rup adults (might be from side mutation). Dr. H. Sawa: weak Psa, One arm gonad. Dr. W. Vermeulen: partial Lva.
Mutation site945/946-CTCTC-1372/1373 (427 bp deletion, 5 bp insertion)
ChromosomeI
Putative gene structurejoin(Z72517:29638..29763, Z72517:29810..30567, 105..344, 397..739, 796..1322, 1401..2346, 2395..3152, 3345..3520, 3570..3670, 3718..3789, 5050..5460, 5558..5771, 5855..6291, 6338..6624, 6677..6800, 6847..6966)
Map position2.1
Balancer
Map position of balancer
Sequence of primersIntFwd:GTTACGCTGGCTGACAACTT,IntRev:AACCACTCAGAACCGCTGAA,ExtFwd:CTGTTCACGAGAAAGATCGA,ExtRev:AGCAAACCAGCAGCCGGAAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Shibata Y, Uchida M, Takeshita H, Nishiwaki K, Sawa H.
Multiple functions of PBRM-1/Polybromo- and LET-526/Osa-containing chromatin remodeling complexes in C. elegans development.
Dev. Biol. 2012 361(2) 349-57 
[ PubMed ID = 22119053 ] [ RRC reference ]

Mathies LD, Blackwell GG, Austin MK, Edwards AC, Riley BP, Davies AG, Bettinger JC.
SWI/SNF chromatin remodeling regulates alcohol response behaviors in Caenorhabditis elegans and is associated with alcohol dependence in humans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(10) 3032-7 
[ PubMed ID = 25713357 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet. 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]

Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]