Mutants (Isolated)

tm4137

Allele Nametm4137
Sequence NameC56C10.1
CGC Namevps-33.2
Worm BaseAllele Name tm4137
CGC Name vps-33.2
Sequence C56C10.1
Phenotypesterile
Mutation site27473/27434-27694/27695 (221 bp deletion)
ChromosomeII
Putative gene structurejoin(27038..27137, 27188..27312, 27363..28746, 28801..28930, 28979..29093)
Map position-0.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CACGCAGGAAGACTCAATTT,ExtRev:GTTGATGTGCCTCCTTGTCT,IntRev:CCAATGGGCCAGTTTGAACT,IntFwd:ATCAACCATGGCACCGGGTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gengyo-Ando K, Kage-Nakadai E, Yoshina S, Otori M, Kagawa-Nagamura Y, Nakai J, Mitani S.
Distinct roles of the two VPS33 proteins in the endolysosomal system in Caenorhabditis elegans.
Traffic 2016 17(11) 1197-1213 
[ PubMed ID = 27558849 ] [ RRC reference ]