Mutants (Isolated)

tm4127

Allele Nametm4127
Sequence NameT09B4.7
CGC NameT09B4.7
Worm BaseAllele Name tm4127
CGC Name T09B4.7
Sequence T09B4.7
Phenotypehomozygous viable.
Mutation site10953/10954-12002/12003 (1049 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(10430..10618, 10873..11036, 11078..11390, 11607..11797, 11844..12015))
Map position0.84
Balancer
Map position of balancer
Sequence of primersExtRev:ATCTCGTGCTACGGTAGGTT,IntFwd:GCCTCAAGACCTTCTGAGTG,ExtFwd:GTGCCGAGCAGTTTTGCCTC,IntRev:GACGTGATGCCATAAAGTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kasuga H, Fukuyama M, Kitazawa A, Kontani K, Katada T.
The microRNA miR-235 couples blast-cell quiescence to the nutritional state.
Nature 2013 497(7450) 503-6 
[ PubMed ID = 23644454 ] [ RRC reference ]

Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann. Neurol. 2013 74(1) 39-52 
[ PubMed ID = 23424178 ] [ RRC reference ]