Mutants (Isolated)

tm4103

Allele Nametm4103
Sequence NameB0303.9
CGC Namevps-33.1
Worm BaseAllele Name tm4103
CGC Name vps-33.1
Sequence B0303.9
Phenotypelethal or sterile.
Mutation site22231/22232-22874/22875 (643 bp deletion)
ChromosomeIII
Putative gene structurejoin(20715..20771, 20828..20950, 21008..21169, 21342..21439, 21533..22043, 22090..22252, 22299..22915)
Map position-0.11
BalancerhT2
Map position of balancer
Sequence of primersIntRev:GCACAGAGTGGAATTGGGAA,ExtRev:GGGCCAGTTGGATAAGGCAC,ExtFwd:ATAACGTGCGGAATGACTCG,IntFwd:CCAAGTGTTCTTCATTCCCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gengyo-Ando K, Kage-Nakadai E, Yoshina S, Otori M, Kagawa-Nagamura Y, Nakai J, Mitani S.
Distinct roles of the two VPS33 proteins in the endolysosomal system in Caenorhabditis elegans.
Traffic 2016 17(11) 1197-1213 
[ PubMed ID = 27558849 ] [ RRC reference ]