Mutants (Isolated)

tm4094

Allele Nametm4094
Sequence NameY38E10A.8
CGC NameY38E10A.8
Worm BaseAllele Name tm4094
CGC Name Y38E10A.8
Sequence Y38E10A.8
Phenotypehomozygous viable.
Mutation site37374/37375-37798/37799 (424 bp deletion)
ChromosomeII
Putative gene structurejoin(37323..37480, 37533..37769, 37814..37927, 37980..38208, 38715..38801)
Map position10.52
Balancer
Map position of balancer
Sequence of primersIntRev:AATGTGCCAGTCTCCCCCCA,ExtRev:CCCGTTCGTTGTTAGTAACT,IntFwd:CTCCACACACACTCGCGCAA,ExtFwd:CCTAATGGGGGCCTCAGCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hirose T, Horvitz HR.
The translational regulators GCN-1 and ABCF-3 act together to promote apoptosis in C. elegans.
PLoS Genet. 2014 10(8) e1004512 
[ PubMed ID = 25101958 ] [ RRC reference ]