Mutants (Isolated)

tm4088

Allele Nametm4088
Sequence NameR05H5.2
CGC Namecdc-25.4
Worm BaseAllele Name tm4088
CGC Name cdc-25.4
Sequence R05H5.2
Phenotypelethal or sterile.
Mutation site4964/4965-5407/5408 (443 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(4569..4862, 4933..5056, 5115..5245, 5287..5451, 5494..5560, 5609..5726, 5796..5858, 7051..7207))
Map position2.19
BalancermIn1
Map position of balancer
Sequence of primersExtFwd:CGGTCGAGCATGCATTGAGA,ExtRev:CCCTTCTGATGAACCGGTCA,IntFwd:GTAACGGGGCTCACATAGAT,IntRev:AGCGAGACCAGGAACGTTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Oh S, Kawasaki I, Park JH, Shim YH.
cdc-25.4, a Caenorhabditis elegans Ortholog of cdc25, Is Required for Male Mating Behavior.
G3 (Bethesda) 2016 6(12) 4127-4138 
[ PubMed ID = 27770028 ] [ RRC reference ]

Oh S, Kawasaki I, Park JH, Shim YH.
cdc-25.4, a Caenorhabditis elegans Ortholog of cdc25, Is Required for Male Mating Behavior.
G3 (Bethesda) 2016 6(12) 4127-4138 
[ PubMed ID = 27770028 ] [ RRC reference ]

Lee YU, Son M, Kim J, Shim YH, Kawasaki I.
CDC-25.2, a C. elegans ortholog of cdc25, is essential for the progression of intestinal divisions.
Cell Cycle 2016 15(5) 654-66 
[ PubMed ID = 27104746 ] [ RRC reference ]