Mutants (Isolated)

tm408

Allele Nametm408
Sequence NameC25B8.3
CGC Namecpr-6
Worm BaseAllele Name tm408
CGC Name cpr-6
Sequence C25B8.3
Phenotypehomozygous viable. Dr. C. Kenyon: normal lifespan.
Mutation site3348/3349-3658/3659 (310 bp deletion)
ChromosomeX
Putative gene structurejoin(2287..2289, 2339..2414, 2462..2556, 2600..2695, 2889..3230, 3285..3557, 3605..3822, 3969..4005)
Map position-2.74
Balancer
Map position of balancer
Sequence of primersExtRev:CCGGAGAGAACAACAGCACG,IntFwd:GGACTCCCAACCGCAAATTA,ExtFwd:GATGACTTAGCAAGACAGGT,IntRev:CACAATCGGAACTGAGCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jang S, Nelson JC, Bend EG, Rodríguez-Laureano L, Tueros FG, Cartagenova L, Underwood K, Jorgensen EM, Colón-Ramos DA.
Glycolytic Enzymes Localize to Synapses under Energy Stress to Support Synaptic Function.
Neuron 2016 90(2) 278-91 
[ PubMed ID = 27068791 ] [ RRC reference ]