Mutants (Isolated)

tm4074

Allele Nametm4074
Sequence NameT11G6.1
CGC Namehars-1
Worm BaseAllele Name tm4074
CGC Name hars-1
Sequence T11G6.1
Phenotypelethal or sterile.
Mutation site23260/23261-23921/23922 (661 bp deletion)
ChromosomeIV
Putative gene structurejoin(22749..22844, 23234..23785, 23834..24242, 24290..24738, 24788..24844)
Map position4.72
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:GAACTATTACGAGTAGGCTG,ExtFwd:ACGCGTTTGCAATCCGCATA,IntRev:GAGTGTCACGAACGGCAGTG,ExtRev:CGATTGTTTAGAGGGCGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pierce SB, Chisholm KM, Lynch ED, Lee MK, Walsh T, Opitz JM, Li W, Klevit RE, King MC.
Mutations in mitochondrial histidyl tRNA synthetase HARS2 cause ovarian dysgenesis and sensorineural hearing loss of Perrault syndrome.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(16) 6543-8 
[ PubMed ID = 21464306 ] [ RRC reference ]

Alriyami MZ, Jones MR, Johnsen RC, Banerjee Y, Baillie DL.
let-65 is cytoplasmic methionyl tRNA synthetase in C. elegans.
Meta Gene 2014 2 819-30 
[ PubMed ID = 25606464 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]