Home > Mutants (Isolated) > tm403

Mutants (Isolated)

Allele Name		tm403
Allele Type		Normal
Sequence Name		C09B8.7a
Gene Name		pak-1
Worm Base	Allele Name	tm403
	Gene Name	pak-1
	Sequence	C09B8.7a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. Y. Jin: could not maintain as homozygote. Dr. M. Labouesse: Development 136, 3109 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		41185/41186-agcaacacatgcatc-42659/42660 (1474 bp deletion, 15 bp addition)
Chromosome		X
Putative gene structure		complement(join(39132..39290, 39448..39519, 40132..40254, 40309..40382, 40433..41000, 41267..41359, 41404..41609, 41667..41814, 42363..42469, 42518..42836))
Map position		-3.78
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTTATGGGCAAAACTGGGGT,ExtRev:TTCGTTTCAGCAGCTCGGCA,IntRev:CGAGGGAGAATCAGGTAATT,IntFwd:TTACTAGGGAATAGTGGCCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Fang C, Wei X, Shao X, Lin Y. Force-mediated cellular anisotropy and plasticity dictate the elongation dynamics of embryos. Sci Adv 2021 7(27)   [ PubMed ID = 34193426 ] [ RRC reference ] Suman SK, Daday C, Ferraro T, Vuong-Brender T, Tak S, Quintin S, Robin F, Gräter F, Labouesse M. The plakin domain of C. elegans VAB-10/plectin acts as a hub in a mechanotransduction pathway to promote morphogenesis. Development 2019 146(24)   [ PubMed ID = 31784459 ] [ RRC reference ] Lardennois A, Pásti G, Ferraro T, Llense F, Mahou P, Pontabry J, Rodriguez D, Kim S, Ono S, Beaurepaire E, Gally C, Labouesse M. An actin-based viscoplastic lock ensures progressive body-axis elongation. Nature 2019 573(7773) 266-270  [ PubMed ID = 31462781 ] [ RRC reference ] Nørgaard S, Deng S, Cao W, Pocock R. Distinct CED-10/Rac1 domains confer context-specific functions in development. PLoS Genet 2018 14(9) e1007670  [ PubMed ID = 30265669 ] [ RRC reference ] Zhang H, Landmann F, Zahreddine H, Rodriguez D, Koch M, Labouesse M. A tension-induced mechanotransduction pathway promotes epithelial morphogenesis. Nature 2011 471(7336) 99-103  [ PubMed ID = 21368832 ] [ RRC reference ] Peters EC, Gossett AJ, Goldstein B, Der CJ, Reiner DJ. Redundant canonical and noncanonical Caenorhabditis elegans p21-activated kinase signaling governs distal tip cell migrations. G3 (Bethesda) 2013 3(2) 181-95  [ PubMed ID = 23390595 ] [ RRC reference ] Goh KY, Ng NW, Hagen T, Inoue T. p21-activated kinase interacts with Wnt signaling to regulate tissue polarity and gene expression. Proc Natl Acad Sci U S A 2012 109(39) 15853-8  [ PubMed ID = 23019370 ] [ RRC reference ] Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development 2009 136(18) 3109-19  [ PubMed ID = 19675126 ] [ RRC reference ]