Mutants (Isolated)

tm4017

Allele Nametm4017
Sequence NameF29C12.3
CGC Namerict-1
Worm BaseAllele Name tm4017
CGC Name rict-1
Sequence F29C12.3
Phenotypehomozygous viable.
Mutation site10304/10305-10476/10477 (172 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(101..184, 1417..1852, 2660..2862, 3696..4746, 10137..10273, 11172..11360, 11420..11927, 12900..13317, 13554..13621, 13678..13764, 13817..14107, 14661..14945, 15007..15096, 16071..16337, 16396..16600, 16658..16751), AL034543.1:18663..18801, AL034543.1:19889..19991, AL034543.1:20063..20303))
Map position14.37
Balancer
Map position of balancer
Sequence of primersExtFwd:ACTCGTCATTGTGAACGTTC,ExtRev:GACCGTCTGACTCCACGTGA,IntFwd:GGTGTAGGAAAGGTTGCGAG,IntRev:CTCCACGTGATTCGTATGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakai N, Ohno H, Tomioka M, Iino Y.
The intestinal TORC2 signaling pathway contributes to associative learning in Caenorhabditis elegans.
PLoS ONE 2017 12(5) e0177900 
[ PubMed ID = 28542414 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]