Mutants (Isolated)

tm3976

Allele Nametm3976
Sequence NameD1007.16
CGC NameD1007.16
Worm BaseAllele Name tm3976
CGC Name D1007.16
Sequence D1007.16
Phenotypehomozygous viable.
Mutation site45967/45968-46224/46225 (257 bp deletion)
ChromosomeI
Putative gene structure45959..46498
Map position-1.04
Balancer
Map position of balancer
Sequence of primersIntRev:GCCACCACTAGTACAAGTAC,IntFwd:CATGGCAGAGTCAAGTGATA,ExtRev:TTGCGATAGATAGCCCGGTT,ExtFwd:CGCGCACACAATTGGCACTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cai L, Phong BL, Fisher AL, Wang Z.
Regulation of fertility, survival, and cuticle collagen function by the Caenorhabditis elegans eaf-1 and ell-1 genes.
J Biol Chem 2011 286(41) 35915-21 
[ PubMed ID = 21880729 ] [ RRC reference ]

Cai L, Wang D, Fisher AL, Wang Z.
Identification of a genetic interaction between the tumor suppressor EAF2 and the retinoblastoma protein (Rb) signaling pathway in C. elegans and prostate cancer cells.
Biochem Biophys Res Commun 2014 447(2) 292-8 
[ PubMed ID = 24727455 ] [ RRC reference ]

Guo W, Keener AL, Jing Y, Cai L, Ai J, Zhang J, Fisher AL, Fu G, Wang Z.
FOXA1 modulates EAF2 regulation of AR transcriptional activity, cell proliferation, and migration in prostate cancer cells.
Prostate 2015 75(9) 976-87 
[ PubMed ID = 25808853 ] [ RRC reference ]