Mutants (Isolated)

tm3951

Allele Nametm3951
Sequence NameF10E9.8
CGC Namesas-4
Worm BaseAllele Name tm3951
CGC Name sas-4
Sequence F10E9.8
Phenotypelethal or sterile
Mutation site38543/38544-39148/39149 (575 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(35732..36020, 36774..36833, 36882..37069, 37116..37274, 37545..37988, 38165..38697, 38740..38959, 39076..39420, 39501..39596, 39645..39737))
Map position-0.33
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:CTAAAGTCTGTAGAGTGCTC,IntFwd:CTTTAGCCGGTTTCCGTCTT,ExtRev:GCCTTCAGATGGCTTCCGAT,IntRev:TATCGGTGCCGACGGTGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kitagawa D, Flückiger I, Polanowska J, Keller D, Reboul J, Gönczy P.
PP2A phosphatase acts upon SAS-5 to ensure centriole formation in C. elegans embryos.
Dev Cell 2011 20(4) 550-62 
[ PubMed ID = 21497765 ] [ RRC reference ]

Cabral G, Sans SS, Cowan CR, Dammermann A.
Multiple mechanisms contribute to centriole separation in C. elegans.
Curr Biol 2013 23(14) 1380-7 
[ PubMed ID = 23885867 ] [ RRC reference ]

Mikeladze-Dvali T, von Tobel L, Strnad P, Knott G, Leonhardt H, Schermelleh L, Gönczy P.
Analysis of centriole elimination during C. elegans oogenesis.
Development 2012 139(9) 1670-9 
[ PubMed ID = 22492357 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]