Allele Name | tm3951 |
Sequence Name | F10E9.8 |
CGC Name | sas-4 |
Worm Base | Allele Name |
tm3951
|
CGC Name |
sas-4
|
Sequence |
F10E9.8
|
Phenotype | lethal or sterile |
Mutation site | 38543/38544-39148/39149 (575 bp deletion) |
Chromosome | III |
Putative gene structure | complement(join(35732..36020, 36774..36833, 36882..37069, 37116..37274, 37545..37988, 38165..38697, 38740..38959, 39076..39420, 39501..39596, 39645..39737)) |
Map position | -0.33 |
Balancer | hT2 [qIs48] |
Map position of balancer | |
Sequence of primers | ExtFwd:CTAAAGTCTGTAGAGTGCTC,IntFwd:CTTTAGCCGGTTTCCGTCTT,ExtRev:GCCTTCAGATGGCTTCCGAT,IntRev:TATCGGTGCCGACGGTGAAC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Kitagawa D, Flückiger I, Polanowska J, Keller D, Reboul J, Gönczy P. PP2A phosphatase acts upon SAS-5 to ensure centriole formation in C. elegans embryos. Dev Cell 2011 20(4) 550-62
[ PubMed ID = 21497765 ]
[ RRC reference ]
|
Cabral G, Sans SS, Cowan CR, Dammermann A. Multiple mechanisms contribute to centriole separation in C. elegans. Curr Biol 2013 23(14) 1380-7
[ PubMed ID = 23885867 ]
[ RRC reference ]
|
Mikeladze-Dvali T, von Tobel L, Strnad P, Knott G, Leonhardt H, Schermelleh L, Gönczy P. Analysis of centriole elimination during C. elegans oogenesis. Development 2012 139(9) 1670-9
[ PubMed ID = 22492357 ]
[ RRC reference ]
|
Serwas D, Su TY, Roessler M, Wang S, Dammermann A. Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans. J Cell Biol 2017 216(6) 1659-1671
[ PubMed ID = 28411189 ]
[ RRC reference ]
|
|