Home > Mutants (Isolated) > tm3948

Mutants (Isolated)

Allele Name		tm3948
Allele Type		Normal
Sequence Name		ZK792.8
Gene Name		atg-4.2
Worm Base	Allele Name	tm3948
	Gene Name	atg-4.2
	Sequence	ZK792.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3623/3624-4121/4122 (498 bp deletion)
Chromosome		IV
Putative gene structure		join(1806..2059, 2647..2786, 2831..2917, 3275..3375, 3423..3733, 3976..4141, 4189..4293, 4341..4430, 4560..4703, 4990..5157)
Map position		5.14
Balancer
Map position of balancer
Sequence of primers		IntRev:GACAGACACCTTTCATCCCT,ExtRev:GCTACGTATACAGGCAAACA,ExtFwd:GAGTATTCGGCCATAGAAAG,IntFwd:AGTGGTCTTCGCTCGGGGTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Min H, Lee YU, Shim YH, Kawasaki I. Autophagy of germ-granule components, PGL-1 and PGL-3, contributes to DNA damage-induced germ cell apoptosis in C. elegans. PLoS Genet 2019 15(5) e1008150  [ PubMed ID = 31125345 ] [ RRC reference ] Palmisano NJ, Meléndez A. Autophagy in C. elegans development. Dev Biol 2019 447(1) 103-125  [ PubMed ID = 29709599 ] [ RRC reference ] Palmisano NJ, Meléndez A. Detection of Autophagy in Caenorhabditis elegans. Cold Spring Harb Protoc 2016 2016(2) pdb.top070466  [ PubMed ID = 26832690 ] [ RRC reference ] Chen HD, Kao CY, Liu BY, Huang SW, Kuo CJ, Ruan JW, Lin YH, Huang CR, Chen YH, Wang HD, Aroian RV, Chen CS. HLH-30/TFEB-mediated autophagy functions in a cell-autonomous manner for epithelium intrinsic cellular defense against bacterial pore-forming toxin in C. elegans. Autophagy 2017 13(2) 371-385  [ PubMed ID = 27875098 ] [ RRC reference ] Chen Y, Scarcelli V, Legouis R. Approaches for Studying Autophagy in Caenorhabditis elegans. Cells 2017 6(3)   [ PubMed ID = 28867808 ] [ RRC reference ] Wu F, Li Y, Wang F, Noda NN, Zhang H. Differential function of the two Atg4 homologues in the aggrephagy pathway in Caenorhabditis elegans. J Biol Chem 2012 287(35) 29457-67  [ PubMed ID = 22767594 ] [ RRC reference ] Cheng S, Wu Y, Lu Q, Yan J, Zhang H, Wang X. Autophagy genes coordinate with the class II PI/PtdIns 3-kinase PIKI-1 to regulate apoptotic cell clearance in C. elegans. Autophagy 2013 9(12) 2022-32  [ PubMed ID = 24165672 ] [ RRC reference ]