Mutants (Isolated)

tm3948

Allele Nametm3948
Sequence NameZK792.8
CGC Nameatg-4.2
Worm BaseAllele Name tm3948
CGC Name atg-4.2
Sequence ZK792.8
Phenotypehomozygous viable.
Mutation site3623/3624-4121/4122 (498 bp deletion)
ChromosomeIV
Putative gene structurejoin(1806..2059, 2647..2786, 2831..2917, 3275..3375, 3423..3733, 3976..4141, 4189..4293, 4341..4430, 4560..4703, 4990..5157)
Map position5.14
Balancer
Map position of balancer
Sequence of primersIntRev:GACAGACACCTTTCATCCCT,ExtRev:GCTACGTATACAGGCAAACA,ExtFwd:GAGTATTCGGCCATAGAAAG,IntFwd:AGTGGTCTTCGCTCGGGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wu F, Li Y, Wang F, Noda NN, Zhang H.
Differential function of the two Atg4 homologues in the aggrephagy pathway in Caenorhabditis elegans.
J. Biol. Chem. 2012 287(35) 29457-67 
[ PubMed ID = 22767594 ] [ RRC reference ]

Cheng S, Wu Y, Lu Q, Yan J, Zhang H, Wang X.
Autophagy genes coordinate with the class II PI/PtdIns 3-kinase PIKI-1 to regulate apoptotic cell clearance in C. elegans.
Autophagy 2013 9(12) 2022-32 
[ PubMed ID = 24165672 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Detection of Autophagy in Caenorhabditis elegans.
Cold Spring Harb Protoc 2016 2016(2) pdb.top070466 
[ PubMed ID = 26832690 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Chen HD, Kao CY, Liu BY, Huang SW, Kuo CJ, Ruan JW, Lin YH, Huang CR, Chen YH, Wang HD, Aroian RV, Chen CS.
HLH-30/TFEB-mediated autophagy functions in a cell-autonomous manner for epithelium intrinsic cellular defense against bacterial pore-forming toxin in C. elegans.
Autophagy 2017 13(2) 371-385 
[ PubMed ID = 27875098 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev. Biol. 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]