Mutants (Isolated)

tm3933

Allele Nametm3933
Sequence NameC49C3.10
CGC NameC49C3.10a
Worm BaseAllele Name tm3933
CGC Name C49C3.10a
Sequence C49C3.10
Phenotypehomozygous viable.
Mutation site26882/26883-27282/27283 (400 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(25970..26128, 26238..26433, 26475..26658, 26973..27141, 27270..27311, 27361..27468, 27514..27673, 27729..27803, 27902..28005))
Map position16.49
Balancer
Map position of balancer
Sequence of primersExtFwd:ACATCCCAAGGACCAGATGT,ExtRev:TGAGACGGCAGAGAGTTATA,IntFwd:AGCGGCAATAGGGGACTTTC,IntRev:GCGCGTATTGATTTTAGCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liachko NF, McMillan PJ, Guthrie CR, Bird TD, Leverenz JB, Kraemer BC.
CDC7 inhibition blocks pathological TDP-43 phosphorylation and neurodegeneration.
Ann Neurol 2013 74(1) 39-52 
[ PubMed ID = 23424178 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]