Mutants (Isolated)

tm393

Allele Nametm393
Sequence NameF54C9.1
CGC Nameiff-2
Worm BaseAllele Name tm393
CGC Name iff-2
Sequence F54C9.1
Phenotypelethal or sterile. Dr. Y. Iino: Mech. Dev. 121, 213-224(2004).
Mutation site6412/6413-6797/6798 (385 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(5683..5886, 5963..6115, 6702..6830))
Map position0.83
Balancerdpy-10 (e128) II
Map position of balancer0
Sequence of primersExtRev:ACCCACACACAGTGATGGGA,IntRev:GATACCGAGTTCAACCGTAT,ExtFwd:CGGTTGCTTTACGAGTCATT,IntFwd:CCAGGATTGCGTTTATAGGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hanazawa M, Kawasaki I, Kunitomo H, Gengyo-Ando K, Bennett KL, Mitani S, Iino Y.
The Caenorhabditis elegans eukaryotic initiation factor 5A homologue, IFF-1, is required for germ cell proliferation, gametogenesis and localization of the P-granule component PGL-1.
Mech. Dev. 2004 121(3) 213-24 
[ PubMed ID = 15003625 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]