Mutants (Isolated)

tm3921

Allele Nametm3921
Sequence NameB0041.5
CGC NameB0041.5
Worm BaseAllele Name tm3921
CGC Name B0041.5
Sequence B0041.5
Phenotypehomozygous viable.
Mutation site5881/5882-6416/6417 (535 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(5303..5604, 5661..5964, 6042..6188, 6474..6605, 7112..7405, 7455..7565))
Map position-1.03
Balancer
Map position of balancer
Sequence of primersIntRev:CCCGAATTAATCTCCGTCCA,IntFwd:ATGCTACTCGTCCGATAGAC,ExtRev:AGCGCACAATTCGGCTGAGT,ExtFwd:CCTATAAAGCGACCAGTAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jones MR, Rose AM, Baillie DL.
The ortholog of the human proto-oncogene ROS1 is required for epithelial development in C. elegans.
Genesis 2013 51(8) 545-61 
[ PubMed ID = 23733356 ] [ RRC reference ]