Mutants (Isolated)

tm3886

Allele Nametm3886
Sequence NameY76B12C.2
CGC Namexpc-1
Worm BaseAllele Name tm3886
CGC Name xpc-1
Sequence Y76B12C.2
Phenotypehomozygous viable.
Mutation site24156/24157-GCTGGGGCTGGGTCGCTAGAAAAA-24630/24631 (474 bp deletion + 24 bp insertion)
ChromosomeIV
Putative gene structurejoin(23205..23327, 23762..24752, 26575..27035, 29494..29817, 31016..31424, 32544..32763, 34005..34302, 35754..35929, 36655..36748, 37743..38006)
Map position-12.3
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCTCCCGCCGACCGCATAT,ExtRev:CTTCCACGGCTGATCGGGTT,IntFwd:GCCGCCCAGCTCTCCATATT,IntRev:CCGCGTTTTTGCTGCCTGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rieckher M, Bujarrabal A, Doll MA, Soltanmohammadi N, Schumacher B.
A simple answer to complex questions: Caenorhabditis elegans as an experimental model for examining the DNA damage response and disease genes.
J. Cell. Physiol. 2018 233(4) 2781-2790 
[ PubMed ID = 28463453 ] [ RRC reference ]

Edifizi D, Nolte H, Babu V, Castells-Roca L, Mueller MM, Brodesser S, Krüger M, Schumacher B.
Multilayered Reprogramming in Response to Persistent DNA Damage in C. elegans.
Cell Rep 2017 20(9) 2026-2043 
[ PubMed ID = 28854356 ] [ RRC reference ]

Wolters S, Ermolaeva MA, Bickel JS, Fingerhut JM, Khanikar J, Chan RC, Schumacher B.
Loss of Caenorhabditis elegans BRCA1 promotes genome stability during replication in smc-5 mutants.
Genetics 2014 196(4) 985-99 
[ PubMed ID = 24424777 ] [ RRC reference ]

Ermolaeva MA, Segref A, Dakhovnik A, Ou HL, Schneider JI, Utermöhlen O, Hoppe T, Schumacher B.
DNA damage in germ cells induces an innate immune response that triggers systemic stress resistance.
Nature 2013 501(7467) 416-20 
[ PubMed ID = 23975097 ] [ RRC reference ]

Babu V, Hofmann K, Schumacher B.
A C. elegans homolog of the Cockayne syndrome complementation group A gene.
DNA Repair (Amst.) 2014 24 57-62 
[ PubMed ID = 25453470 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet. 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ. 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]