Mutants (Isolated)

tm388

Allele Nametm388
Sequence NameB0414.2
CGC Namernt-1
Worm BaseAllele Name tm388
CGC Name rnt-1
Sequence B0414.2
Phenotypehomozygous viable. Dr. J. Lee: short body length. Dr. M. Herman: phasmid Dyf.
Mutation site13728/13729-14786/14787 (1058 bp deletion)
ChromosomeI
Putative gene structurejoin (13159..13173, 13218..13335, 13592..13711, 14513..14586, 15563..15679, 16289..16347, 16400..16518, 16571..16800)
Map position0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GCAAAAGTGCATCGACAAGT,IntFwd:TTTGCGGTTTGTCGGGCGGT,IntRev:CAGGCGTTCGGATAATATCA,ExtRev:CAAAAAATCGTACCGGTGGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kagoshima H, Shigesada K, Kohara Y.
RUNX regulates stem cell proliferation and differentiation: insights from studies of C. elegans.
J. Cell. Biochem. 2007 100(5) 1119-30 
[ PubMed ID = 17265434 ] [ RRC reference ]

Ji YJ, Singaravelu G, Ahnn J.
RNT-1 regulation in C. elegans.
J. Cell. Biochem. 2005 96(1) 8-15 
[ PubMed ID = 15988754 ] [ RRC reference ]

Kagoshima H, Sawa H, Mitani S, Bürglin TR, Shigesada K, Kohara Y.
The C. elegans RUNX transcription factor RNT-1/MAB-2 is required for asymmetrical cell division of the T blast cell.
Dev. Biol. 2005 287(2) 262-73 
[ PubMed ID = 16226243 ] [ RRC reference ]

Shim J, Lee J.
Regulation of rnt-1 expression mediated by the opposing effects of BRO-1 and DBL-1 in the nematode Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2008 367(1) 130-6 
[ PubMed ID = 18158917 ] [ RRC reference ]

Hughes S, Brabin C, Appleford PJ, Woollard A.
CEH-20/Pbx and UNC-62/Meis function upstream of rnt-1/Runx to regulate asymmetric divisions of the C. elegans stem-like seam cells.
Biol Open 2013 2(7) 718-27 
[ PubMed ID = 23862020 ] [ RRC reference ]

Lee K, Shim J, Bae J, Kim YJ, Lee J.
Stabilization of RNT-1 protein, runt-related transcription factor (RUNX) protein homolog of Caenorhabditis elegans, by oxidative stress through mitogen-activated protein kinase pathway.
J. Biol. Chem. 2012 287(13) 10444-52 
[ PubMed ID = 22308034 ] [ RRC reference ]

Hajduskova M, Jindra M, Herman MA, Asahina M.
The nuclear receptor NHR-25 cooperates with the Wnt/beta-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans.
J. Cell. Sci. 2009 122(Pt 17) 3051-60 
[ PubMed ID = 19654209 ] [ RRC reference ]

Lee K, Shim J, Lee J, Lee J.
Identification of genes interacting with rnt-1 through large-scale RNAi screening in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(10) 1779-84 
[ PubMed ID = 23979934 ] [ RRC reference ]

Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S, Kohara Y, Woollard A.
The C. elegans CBFbeta homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal.
Development 2007 134(21) 3905-15 
[ PubMed ID = 17933794 ] [ RRC reference ]