Mutants (Isolated)

tm388

Allele Name

tm388

Sequence Name

B0414.2

CGC Name

rnt-1

Worm Base

Allele Name

tm388

CGC Name

rnt-1

Sequence

B0414.2

Phenotype

homozygous viable. Dr. J. Lee: short body length. Dr. M. Herman: phasmid Dyf.

Mutation site

13728/13729-14786/14787 (1058 bp deletion)

Chromosome

Putative gene structure

join (13159..13173, 13218..13335, 13592..13711, 14513..14586, 15563..15679, 16289..16347, 16400..16518, 16571..16800)

Map position

0.45

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GCAAAAGTGCATCGACAAGT,IntFwd:TTTGCGGTTTGTCGGGCGGT,IntRev:CAGGCGTTCGGATAATATCA,ExtRev:CAAAAAATCGTACCGGTGGT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

van der Horst SEM, Cravo J, Woollard A, Teapal J, van den Heuvel S.
C. elegans Runx/CBFβ suppresses POP-1 TCF to convert asymmetric to proliferative division of stem cell-like seam cells.
Development 2019 146(22)
[ PubMed ID = 31740621 ] [ RRC reference ]

Robinson SB, Refai O, Hardaway JA, Sturgeon S, Popay T, Bermingham DP, Freeman P, Wright J, Blakely RD.
Dopamine-dependent, swimming-induced paralysis arises as a consequence of loss of function mutations in the RUNX transcription factor RNT-1.
PLoS One 2019 14(5) e0216417
[ PubMed ID = 31083672 ] [ RRC reference ]

Lee K, Shim J, Bae J, Kim YJ, Lee J.
Stabilization of RNT-1 protein, runt-related transcription factor (RUNX) protein homolog of Caenorhabditis elegans, by oxidative stress through mitogen-activated protein kinase pathway.
J Biol Chem 2012 287(13) 10444-52
[ PubMed ID = 22308034 ] [ RRC reference ]

Hughes S, Brabin C, Appleford PJ, Woollard A.
CEH-20/Pbx and UNC-62/Meis function upstream of rnt-1/Runx to regulate asymmetric divisions of the C. elegans stem-like seam cells.
Biol Open 2013 2(7) 718-27
[ PubMed ID = 23862020 ] [ RRC reference ]

Lee K, Shim J, Lee J, Lee J.
Identification of genes interacting with rnt-1 through large-scale RNAi screening in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(10) 1779-84
[ PubMed ID = 23979934 ] [ RRC reference ]

Kagoshima H, Shigesada K, Kohara Y.
RUNX regulates stem cell proliferation and differentiation: insights from studies of C. elegans.
J Cell Biochem 2007 100(5) 1119-30
[ PubMed ID = 17265434 ] [ RRC reference ]

Hajduskova M, Jindra M, Herman MA, Asahina M.
The nuclear receptor NHR-25 cooperates with the Wnt/beta-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans.
J Cell Sci 2009 122(Pt 17) 3051-60
[ PubMed ID = 19654209 ] [ RRC reference ]

Shim J, Lee J.
Regulation of rnt-1 expression mediated by the opposing effects of BRO-1 and DBL-1 in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2008 367(1) 130-6
[ PubMed ID = 18158917 ] [ RRC reference ]

Kagoshima H, Sawa H, Mitani S, Bürglin TR, Shigesada K, Kohara Y.
The C. elegans RUNX transcription factor RNT-1/MAB-2 is required for asymmetrical cell division of the T blast cell.
Dev Biol 2005 287(2) 262-73
[ PubMed ID = 16226243 ] [ RRC reference ]

Ji YJ, Singaravelu G, Ahnn J.
RNT-1 regulation in C. elegans.
J Cell Biochem 2005 96(1) 8-15
[ PubMed ID = 15988754 ] [ RRC reference ]

Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S, Kohara Y, Woollard A.
The C. elegans CBFbeta homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal.
Development 2007 134(21) 3905-15
[ PubMed ID = 17933794 ] [ RRC reference ]