Mutants (Isolated)

tm3867

Allele Nametm3867
Sequence NameY49E10.2
CGC Nameglrx-5
Worm BaseAllele Name tm3867
CGC Name glrx-5
Sequence Y49E10.2
Phenotypelethal or sterile.
Mutation site6148/6149-6507/6508 (359 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(5233..5457, 6234..6437))
Map position17.23
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:TTAGCGATTCGCTCGGCCCA,ExtRev:TGATTGCGAAATAGTGCCCT,IntFwd:TGAACCAATCAGACGGTATG,IntRev:AGTGCCCTATGACGCCCGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK.
Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis.
Cell 2019 177(6) 1507-1521.e16 
[ PubMed ID = 31031004 ] [ RRC reference ]