Mutants (Isolated)

tm3860

Allele Nametm3860
Sequence NameY37E11AR.4
CGC NameY37E11AR.4
Worm BaseAllele Name tm3860
CGC Name Y37E11AR.4
Sequence Y37E11AR.4
Phenotypehomozygous viable.
Mutation site4303/4304-4784/4785 (481 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(3932..4048, 4101..4218, 4264..4620, 4675..5079, 5126..5199))
Map position-2.41
Balancer
Map position of balancer
Sequence of primersIntFwd:AGTACCTCTGTTGTCCCCAT,ExtFwd:CTCCCGAGCATCCATCAGCT,IntRev:ATGAGCCTACCGACAACCTC,ExtRev:GATTCTCTAGGCACCGTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Folick A, Oakley HD, Yu Y, Armstrong EH, Kumari M, Sanor L, Moore DD, Ortlund EA, Zechner R, Wang MC.
Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans.
Science 2015 347(6217) 83-6 
[ PubMed ID = 25554789 ] [ RRC reference ]

Pastuhov SI, Matsumoto K, Hisamoto N.
Endocannabinoid signaling regulates regenerative axon navigation in Caenorhabditis elegans via the GPCRs NPR-19 and NPR-32.
Genes Cells 2016 21(7) 696-705 
[ PubMed ID = 27193416 ] [ RRC reference ]

Harrison N, Lone MA, Kaul TK, Reis Rodrigues P, Ogungbe IV, Gill MS.
Characterization of N-acyl phosphatidylethanolamine-specific phospholipase-D isoforms in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(11) e113007 
[ PubMed ID = 25423491 ] [ RRC reference ]