Home > Mutants (Isolated) > tm3860

Mutants (Isolated)

Allele Name		tm3860
Allele Type		Normal
Sequence Name		Y37E11AR.4
Gene Name		Y37E11AR.4
Worm Base	Allele Name	tm3860
	Gene Name	Y37E11AR.4
	Sequence	Y37E11AR.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4303/4304-4784/4785 (481 bp deletion)
Chromosome		IV
Putative gene structure		complement(join(3932..4048, 4101..4218, 4264..4620, 4675..5079, 5126..5199))
Map position		-2.41
Balancer
Map position of balancer
Sequence of primers		IntFwd:AGTACCTCTGTTGTCCCCAT,ExtFwd:CTCCCGAGCATCCATCAGCT,IntRev:ATGAGCCTACCGACAACCTC,ExtRev:GATTCTCTAGGCACCGTCAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Pastuhov SI, Matsumoto K, Hisamoto N. Endocannabinoid signaling regulates regenerative axon navigation in Caenorhabditis elegans via the GPCRs NPR-19 and NPR-32. Genes Cells 2016 21(7) 696-705  [ PubMed ID = 27193416 ] [ RRC reference ] Harrison N, Lone MA, Kaul TK, Reis Rodrigues P, Ogungbe IV, Gill MS. Characterization of N-acyl phosphatidylethanolamine-specific phospholipase-D isoforms in the nematode Caenorhabditis elegans. PLoS One 2014 9(11) e113007  [ PubMed ID = 25423491 ] [ RRC reference ] Folick A, Oakley HD, Yu Y, Armstrong EH, Kumari M, Sanor L, Moore DD, Ortlund EA, Zechner R, Wang MC. Aging. Lysosomal signaling molecules regulate longevity in Caenorhabditis elegans. Science 2015 347(6217) 83-6  [ PubMed ID = 25554789 ] [ RRC reference ]