Mutants (Isolated)

tm3855

Allele Nametm3855
Sequence NameZK563.5
CGC Namesorf-1
Worm BaseAllele Name tm3855
CGC Name sorf-1
Sequence ZK563.5
Phenotypehomozygous viable.
Mutation site11253/11254-11678/11679 (425 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(9861..9960, 10702..10757, 10806..10981, 11031..11184, 11258..11368, 11427..11549))
Map position-10.41
Balancer
Map position of balancer
Sequence of primersExtFwd:GACTATTTCCGGGTCCCATA,IntRev:GATCGATGAACGCACACCTT,IntFwd:CTGAGGACAGTAGTTGCGTA,ExtRev:GCCAATATAAATCGGCAGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]