Mutants (Isolated)

tm3841

Allele Nametm3841
Sequence NameC04G2.2
CGC NameC04G2.2
Worm BaseAllele Name tm3841
CGC Name C04G2.2
Sequence C04G2.2
Phenotypehomozygous viable.
Mutation site4324/4325-4861/4862 (537 bp deletion)
ChromosomeIV
Putative gene structurejoin(3847..3914, 4201..4427, 4480..4736, 4789..5102, 5149..5236, 5281..5448)
Map position4.5
Balancer
Map position of balancer
Sequence of primersIntRev:ATCCGCCGGAGAGATTGATG,IntFwd:AAATCTTGTTGCTCTGCCCA,ExtRev:GGGAGGTGGTCCATTGATTC,ExtFwd:CTATTTAATGAGCGCGGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]