Mutants (Isolated)

tm3827

Allele Nametm3827
Sequence NameT11F1.8
CGC NameT11F1.8
Worm BaseAllele Name tm3827
CGC Name T11F1.8
Sequence T11F1.8
Phenotypehomozygous viable.
Mutation site12333/12334-12507/12508 (174 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(12031..12160, 12351..12418, 12468..12857, 13579..13854, 13900..14094, 14152..14409, 15013..15103))
Map position-9.2
Balancer
Map position of balancer
Sequence of primersExtFwd:TGACGGAGTAAGTAGGTGGT,ExtRev:TGTCGGCAGGTGCACAGGAT,IntFwd:GTAGGTGGTAATTACGCCGA,IntRev:ACTCAAACAGCCGACATCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yu S, Driscoll M.
EGF signaling comes of age: promotion of healthy aging in C. elegans.
Exp Gerontol 2011 46(2-3) 129-34 
[ PubMed ID = 21074601 ] [ RRC reference ]

Iwasa H, Yu S, Xue J, Driscoll M.
Novel EGF pathway regulators modulate C. elegans healthspan and lifespan via EGF receptor, PLC-gamma, and IP3R activation.
Aging Cell 2010 9(4) 490-505 
[ PubMed ID = 20497132 ] [ RRC reference ]