Mutants (Isolated)

tm3813

Allele Nametm3813
Sequence NameK07B1.1
CGC Nametry-5
Worm BaseAllele Name tm3813
CGC Name try-5
Sequence K07B1.1
Phenotypehomozygous viable.
Mutation site19584/19585-19895/19896 (311 bp deletion)
ChromosomeV
Putative gene structurejoin(19723..20163, 20205..20484, 20914..21011, 21055..21237)
Map position2.01
Balancer
Map position of balancer
Sequence of primersIntRev:CTTAGACCTACCCAAAGTCA,ExtFwd:AACACCTTATCTCCTGTCGT,IntFwd:CCTGTCGTTTCGATACATCT,ExtRev:TGCGTTGTAGAACTTAGACC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fenker KE, Hansen AA, Chong CA, Jud MC, Duffy BA, Norton JP, Hansen JM, Stanfield GM.
SLC6 family transporter SNF-10 is required for protease-mediated activation of sperm motility in C. elegans.
Dev. Biol. 2014 393(1) 171-82 
[ PubMed ID = 24929237 ] [ RRC reference ]

Smith JR, Stanfield GM.
TRY-5 is a sperm-activating protease in Caenorhabditis elegans seminal fluid.
PLoS Genet. 2011 7(11) e1002375 
[ PubMed ID = 22125495 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]