Mutants (Isolated)

tm3809

Allele Nametm3809
Sequence NameC50H11.15
CGC Namecyp-33C9
Worm BaseAllele Name tm3809
CGC Name cyp-33C9
Sequence C50H11.15
Phenotypehomozygous viable.
Mutation site40691/40692-41137/41138 (442 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(39098..39205, 39251..39424, 39482..39830, 40499..40797, 40850..41328, 41641..41722))
Map position-12.79
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGCCTGAACCAAGTGTTGC,IntFwd:AGATATATCTGCTCAGGCGT,ExtRev:AGAGGCGAAATTGGCCAGCT,IntRev:GCCCTACCCCACTTCCACTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]