Home > Mutants (Isolated) > tm3802

Mutants (Isolated)

Allele Name		tm3802
Allele Type		Normal
Sequence Name		C38H2.1
Gene Name		tbc-8
Worm Base	Allele Name	tm3802
	Gene Name	tbc-8
	Sequence	C38H2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		13064/13065-AAA-13442/13443 (378 bp deletion + 3 bp insertion)
Chromosome		III
Putative gene structure		join(7589..7713, 8272..8389, 8942..9267, 9433..9506, 11248..11375, 11850..11886, 12258..12611, 12817..12982, 13230..13283, 13332..13533, 13696..13863, 13953..14081, 14129..14271, 14318..14415, 14461..14570, 14794..14890, 15240..15410, 15455..15546)
Map position		2.47
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CCCTTTTTGTGCCTAGCAAC,IntFwd:ACTCCCCGAGCAGCTGATAT,ExtRev:GTAAGCAGGGTTACTGTATG,IntRev:TGGTTGCCTCTCTCACCTGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Hannemann M, Sasidharan N, Hegermann J, Kutscher LM, Koenig S, Eimer S. TBC-8, a putative RAB-2 GAP, regulates dense core vesicle maturation in Caenorhabditis elegans. PLoS Genet 2012 8(5) e1002722  [ PubMed ID = 22654674 ] [ RRC reference ]