Mutants (Isolated)

tm377

Allele Nametm377
Sequence NameC27F2.2
CGC Namenca-2
Worm BaseAllele Name tm377
CGC Name nca-2
Sequence C27F2.2
Phenotypehomozygous viable
Mutation site20696/20697+c-21051/21052 (355 bp deletion)
ChromosomeIII
Putative gene structurejoin(8279..8306, 12829..12999, 13917..14245, 14322..14434, 14513..14933, 15171..15365, 15419..15662, 16126..16376, 16485..16622, 16671..16956, 17376..17766, 17818..17994, 18046..18181, 18330..18461, 18512..18679, 18980..19312, 19434..19947, 20185..20437, 20493..20722, 20985..21258, 21320..21482, 21532..21699, 21952..22194)
Map position-2.29
Balancer
Map position of balancer
Sequence of primersExtFwd:GCAAATGCAGGAGTTGTGTT,IntFwd:GACAAGCTGTTGGAAAGTGA,ExtRev:CTGGACTGCGAAAAGGAAGA,IntRev:GACAATGACGAGAAGCTGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Speca DJ, Chihara D, Ashique AM, Bowers MS, Pierce-Shimomura JT, Lee J, Rabbee N, Speed TP, Gularte RJ, Chitwood J, Medrano JF, Liao M, Sonner JM, Eger EI 2nd, Peterson AS, McIntire SL.
Conserved role of unc-79 in ethanol responses in lightweight mutant mice.
PLoS Genet. 2010 6(8)  
[ PubMed ID = 20714347 ] [ RRC reference ]