Mutants (Isolated)

tm3768

Allele Nametm3768
Sequence NameF40F12.5
CGC Namecyld-1
Worm BaseAllele Name tm3768
CGC Name cyld-1
Sequence F40F12.5
Phenotypehomozygous viable.
Mutation site9742/9743-10238/10239 (496 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(8582..8731, 8843..9554, 9627..9875, 10568..10884, 11173..11308, 11359..11507, 12150..12309, 12354..12456, 13402..13486, 16531..16635, 18671..18779, 18823..18899, 19180..19305, 19699..19938, 19993..20150, 20203..20239))
Map position1.15
Balancer
Map position of balancer
Sequence of primersExtFwd:GATCAGCCATCGAATCAAAG,IntRev:GAGTCAACAGATGCCAGCTG,ExtRev:CGTCGATTATCTTCCTCGAG,IntFwd:CTATGCACAGAACCGCTGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fernández-Majada V, Welz PS, Ermolaeva MA, Schell M, Adam A, Dietlein F, Komander D, Büttner R, Thomas RK, Schumacher B, Pasparakis M.
The tumour suppressor CYLD regulates the p53 DNA damage response.
Nat Commun 2016 7 12508 
[ PubMed ID = 27561390 ] [ RRC reference ]