Mutants (Isolated)

tm376

Allele Nametm376
Sequence NameC14F5.1
CGC Namedct-1
Worm BaseAllele Name tm376
CGC Name dct-1
Sequence C14F5.1
Phenotypehomozygous viable
Mutation site23548/23549-24460/24461 (912 bp deletion)
ChromosomeX
Putative gene structurejoin(24815..24977, 25160..25415, 25847..26017, 26068..26110)
Map position-0.84
Balancer
Map position of balancer
Sequence of primersExtFwd:ACAGAGAGCGTCTGTGTTTG,IntFwd:TTCGCCGCAAGTTTATTGGC,IntRev:TCAAGGGAGATCGAGTGTAC,ExtRev:ATGATTCCTGTCGGATGCGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Aspernig H, Heimbucher T, Qi W, Gangurde D, Curic S, Yan Y, Donner von Gromoff E, Baumeister R, Thien A.
Mitochondrial Perturbations Couple mTORC2 to Autophagy in C. elegans.
Cell Rep 2019 29(6) 1399-1409.e5 
[ PubMed ID = 31693882 ] [ RRC reference ]

Fang EF, Hou Y, Palikaras K, Adriaanse BA, Kerr JS, Yang B, Lautrup S, Hasan-Olive MM, Caponio D, Dan X, Rocktäschel P, Croteau DL, Akbari M, Greig NH, Fladby T, Nilsen H, Cader MZ, Mattson MP, Tavernarakis N, Bohr VA.
Mitophagy inhibits amyloid-β and tau pathology and reverses cognitive deficits in models of Alzheimer's disease.
Nat Neurosci 2019 22(3) 401-412 
[ PubMed ID = 30742114 ] [ RRC reference ]

Palikaras K, Lionaki E, Tavernarakis N.
Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans.
Nature 2015 521(7553) 525-8 
[ PubMed ID = 25896323 ] [ RRC reference ]

Schiavi A, Maglioni S, Palikaras K, Shaik A, Strappazzon F, Brinkmann V, Torgovnick A, Castelein N, De Henau S, Braeckman BP, Cecconi F, Tavernarakis N, Ventura N.
Iron-Starvation-Induced Mitophagy Mediates Lifespan Extension upon Mitochondrial Stress in C. elegans.
Curr Biol 2015 25(14) 1810-22 
[ PubMed ID = 26144971 ] [ RRC reference ]