Mutants (Isolated)

tm3750

Allele Nametm3750
Sequence NameF27D4.2
CGC NameF27D4.2
Worm BaseAllele Name tm3750
CGC Name F27D4.2
Sequence F27D4.2
Phenotypelethal or sterile.
Mutation site3662/3663-3965/3966 (303 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(2741..3076, 3496..4122))
Map position2.3
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntRev:AGTGGATCAGCCAGCGGAAT,ExtRev:CATCCTAGCTCGAGTAGTTC,IntFwd:TAAATCCGTGCCCCTAAGAG,ExtFwd:CGCCGACCCCATCTGGATAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Flowers EB, Poole RJ, Tursun B, Bashllari E, Pe'er I, Hobert O.
The Groucho ortholog UNC-37 interacts with the short Groucho-like protein LSY-22 to control developmental decisions in C. elegans.
Development 2010 137(11) 1799-805 
[ PubMed ID = 20431118 ] [ RRC reference ]