Mutants (Isolated)

tm3748

Allele Nametm3748
Allele TypeNormal
Sequence NameB0379.3
Gene Namemut-16
Worm BaseAllele Name tm3748
Gene Name mut-16
Sequence B0379.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15507/15508-16058/16059 (551 bp deletion)
ChromosomeI
Putative gene structurejoin(13467..13706, 13751..13873, 13915..14094, 14141..14265, 14718..15109, 15160..15282, 15328..15440, 15521..15950, 16150..16458, 16509..16692, 17655..18378, 18672..18824)
Map position4.59
Balancer
Map position of balancer
Sequence of primersExtFwd:TGACTATTGTGCCGATTCAC,IntRev:AGGCGGAATATCGTTGGTGT,ExtRev:GGGAGAGCTACATTCACAGT,IntFwd:TCGATCGGTGGTGTTTCCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen S, Liu W, Xiong L, Tao Z, Zhao D.
Tissue-specific silencing of integrated transgenes achieved through endogenous RNA interference in Caenorhabditis elegans.
RNA Biol 2024 21(1) 1-10 
[ PubMed ID = 38531838 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Cell 2015 160(3) 407-19 
[ PubMed ID = 25635455 ] [ RRC reference ]