Home > Mutants (Isolated) > tm3748

Mutants (Isolated)

Allele Name		tm3748
Allele Type		Normal
Sequence Name		B0379.3
Gene Name		mut-16
Worm Base	Allele Name	tm3748
	Gene Name	mut-16
	Sequence	B0379.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		15507/15508-16058/16059 (551 bp deletion)
Chromosome		I
Putative gene structure		join(13467..13706, 13751..13873, 13915..14094, 14141..14265, 14718..15109, 15160..15282, 15328..15440, 15521..15950, 16150..16458, 16509..16692, 17655..18378, 18672..18824)
Map position		4.59
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TGACTATTGTGCCGATTCAC,IntRev:AGGCGGAATATCGTTGGTGT,ExtRev:GGGAGAGCTACATTCACAGT,IntFwd:TCGATCGGTGGTGTTTCCTC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Chen S, Liu W, Xiong L, Tao Z, Zhao D. Tissue-specific silencing of integrated transgenes achieved through endogenous RNA interference in Caenorhabditis elegans. RNA Biol 2024 21(1) 1-10  [ PubMed ID = 38531838 ] [ RRC reference ] Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y. A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans. Neuron 2018 97(3) 511-519.e6  [ PubMed ID = 29395906 ] [ RRC reference ] Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi. Cell 2015 160(3) 407-19  [ PubMed ID = 25635455 ] [ RRC reference ]