Home > Mutants (Isolated) > tm3740

Mutants (Isolated)

Allele Name		tm3740
Allele Type		Normal
Sequence Name		H14E04.5
Gene Name		cic-1
Worm Base	Allele Name	tm3740
	Gene Name	cic-1
	Sequence	H14E04.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		32136/32137-32310/31311 (174 bp deletion)
Chromosome		III
Putative gene structure		complement(join(25568..25726, 26952..27133, 29556..29750, 31846..31967, 32020..32131, 32188..32294, 32342..32373))
Map position		-14.52
Balancer
Map position of balancer
Sequence of primers		IntFwd:ACGCACAAACGATAGCTGTA,ExtFwd:GGCGTTTTTAGGAAAGCATC,IntRev:CTACCGCGTAAAGACATACA,ExtRev:TAGCCATAATCCACCAGCTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Besnard F, Picao-Osorio J, Dubois C, Félix MA. A broad mutational target explains a fast rate of phenotypic evolution. Elife 2020 9   [ PubMed ID = 32851977 ] [ RRC reference ] Grants JM, Ying LT, Yoda A, You CC, Okano H, Sawa H, Taubert S. The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and Represses Vulval Cell Fate Specification in Caenorhabditis elegans. Genetics 2016 202(2) 583-99  [ PubMed ID = 26715664 ] [ RRC reference ] Luo S, Horvitz HR. The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage. Curr Biol 2017 27(5) 661-672  [ PubMed ID = 28238659 ] [ RRC reference ] Doitsidou M, Minevich G, Kroll JR, Soete G, Gowtham S, Korswagen HC, Sebastiaan van Zon J, Hobert O. A Caenorhabditis elegans Zinc Finger Transcription Factor, ztf-6, Required for the Specification of a Dopamine Neuron-Producing Lineage. G3 (Bethesda) 2018 8(1) 17-26  [ PubMed ID = 29301976 ] [ RRC reference ] Underwood RS, Deng Y, Greenwald I. Integration of EGFR and LIN-12/Notch Signaling by LIN-1/Elk1, the Cdk8 Kinase Module, and SUR-2/Med23 in Vulval Precursor Cell Fate Patterning in Caenorhabditis elegans. Genetics 2017 207(4) 1473-1488  [ PubMed ID = 28954762 ] [ RRC reference ] Zaslaver A, Baugh LR, Sternberg PW. Metazoan operons accelerate recovery from growth-arrested states. Cell 2011 145(6) 981-92  [ PubMed ID = 21663799 ] [ RRC reference ] Steimel A, Suh J, Hussainkhel A, Deheshi S, Grants JM, Zapf R, Moerman DG, Taubert S, Hutter H. The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation. Dev Biol 2013 377(2) 385-98  [ PubMed ID = 23458898 ] [ RRC reference ]