Mutants (Isolated)

tm3735

Allele Nametm3735
Sequence NameC06H2.3
CGC Namejmjd-5
Worm BaseAllele Name tm3735
CGC Name jmjd-5
Sequence C06H2.3
Phenotypehomozygous viable.
Mutation site7064/7065-AA-7685/7686 (621 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurejoin(5980..6130, 6178..6257, 6335..6465, 6513..6617, 6663..6753, 6874..7164, 7216..7656, 7701..7982, 8352..8516)
Map position2.95
Balancer
Map position of balancer
Sequence of primersExtFwd:ACGAGTGTCGCGACGGAGTT,IntFwd:CTGTCCGGAGAGCATGGAAT,ExtRev:CCTGTGGCCCAATCCACATA,IntRev:GGCGATGTTGTGCAAGATAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Amendola PG, Zaghet N, Ramalho JJ, Vilstrup Johansen J, Boxem M, Salcini AE.
JMJD-5/KDM8 regulates H3K36me2 and is required for late steps of homologous recombination and genome integrity.
PLoS Genet. 2017 13(2) e1006632 
[ PubMed ID = 28207814 ] [ RRC reference ]