Mutants (Isolated)

tm3734

Allele Nametm3734
Sequence NameZK973.3
CGC NameZK973.3
Worm BaseAllele Name tm3734
CGC Name ZK973.3
Sequence ZK973.3
Phenotypehomozygous viable.
Mutation site48011/48012-48516/48517 (505 bp deletion)
ChromosomeI
Putative gene structurejoin(47506..47582, 47641..47747, 47863..47984, 48228..49175, 49572..49673)
Map position-1.39
Balancer
Map position of balancer
Sequence of primersIntFwd:CGGGCTATTTGTTTATCCGT,ExtRev:CCTACTTAAAGGCGCACAGA,IntRev:GTGCCTTTGTGAAGGTAATC,ExtFwd:TTGAGAGAGAGGGGTCCCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Narasimhan SD, Yen K, Bansal A, Kwon ES, Padmanabhan S, Tissenbaum HA.
PDP-1 links the TGF-β and IIS pathways to regulate longevity, development, and metabolism.
PLoS Genet 2011 7(4) e1001377 
[ PubMed ID = 21533078 ] [ RRC reference ]