Mutants (Isolated)

tm373

Allele Nametm373
Sequence NameC48D1.3
CGC Namecho-1
Worm BaseAllele Name tm373
CGC Name cho-1
Sequence C48D1.3
Phenotypehomozygous viable. Dr. S. McIntire: normal locomotion and egg laying. Dr. J. Rand: moderate aldicarb resistence, slow thrashing, fatiques when swimming.
Mutation site18992/18993-20687/20688 (1695 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(16940..17126, 18419..18597, 18985..19442, 19553..19879, 19925..19961, 20333..20481, 20789..20987, 21037..21152, 21373..21616))
Map position8.47
Balancer
Map position of balancer
Sequence of primersIntFwd:AGGTCTCACTACTAACAGCA,IntRev:ATGGGCGGGTAGAAAATCGA,ExtFwd:GGGGGAATTGCATTCCGTCA,ExtRev:GTGCTCATTCTTGTCGTTGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Matthies DS, Fleming PA, Wilkes DM, Blakely RD.
The Caenorhabditis elegans choline transporter CHO-1 sustains acetylcholine synthesis and motor function in an activity-dependent manner.
J. Neurosci. 2006 26(23) 6200-12 
[ PubMed ID = 16763028 ] [ RRC reference ]

Mullen GP, Mathews EA, Vu MH, Hunter JW, Frisby DL, Duke A, Grundahl K, Osborne JD, Crowell JA, Rand JB.
Choline transport and de novo choline synthesis support acetylcholine biosynthesis in Caenorhabditis elegans cholinergic neurons.
Genetics 2007 177(1) 195-204 
[ PubMed ID = 17603106 ] [ RRC reference ]

Rand JB.
Acetylcholine.
WormBook 2007  1-21 
[ PubMed ID = 18050502 ] [ RRC reference ]

Kim H, Rogers MJ, Richmond JE, McIntire SL.
SNF-6 is an acetylcholine transporter interacting with the dystrophin complex in Caenorhabditis elegans.
Nature 2004 430(7002) 891-6 
[ PubMed ID = 15318222 ] [ RRC reference ]

Wang H, Salter CG, Refai O, Hardy H, Barwick KES, Akpulat U, Kvarnung M, Chioza BA, Harlalka G, Taylan F, Sejersen T, Wright J, Zimmerman HH, Karakaya M, Stüve B, Weis J, Schara U, Russell MA, Abdul-Rahman OA, Chilton J, Blakely RD, Baple EL, Cirak S, Crosby AH.
Choline transporter mutations in severe congenital myasthenic syndrome disrupt transporter localization.
Brain 2017 140(11) 2838-2850 
[ PubMed ID = 29088354 ] [ RRC reference ]