Mutants (Isolated)

tm3716

Allele Nametm3716
Sequence NameY71H2AL.1
CGC NameY71H2AL.1
Worm BaseAllele Name tm3716
CGC Name Y71H2AL.1
Sequence Y71H2AL.1
PhenotypeGro (Dr. M.A. Peters)
Mutation site9531/9532-9779/9780 (248 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(9582..9635, 9682..9795, 10026..10096, 10141..10256, 13106..13173, 13629..13732, 14425..14488))
Map position-11.57
Balancer
Map position of balancer
Sequence of primersIntRev:AGCCCACAGCGCTAATTCGA,IntFwd:GCGTTCACCATACAACAGAT,ExtRev:AGTCCGCGACAGCAACACAC,ExtFwd:CAGTGGGTTCAGTGCTCAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Allman E, Wang Q, Walker RL, Austen M, Peters MA, Nehrke K.
Calcineurin homologous proteins regulate the membrane localization and activity of sodium/proton exchangers in C. elegans.
Am. J. Physiol., Cell Physiol. 2016 310(3) C233-42 
[ PubMed ID = 26561640 ] [ RRC reference ]

Wagner J, Allman E, Taylor A, Ulmschneider K, Kovanda T, Ulmschneider B, Nehrke K, Peters MA.
A calcineurin homologous protein is required for sodium-proton exchange events in the C. elegans intestine.
Am. J. Physiol., Cell Physiol. 2011 301(6) C1389-403 
[ PubMed ID = 21865588 ] [ RRC reference ]