Mutants (Isolated)

tm3713

Allele Nametm3713
Sequence NameF29B9.2
CGC Namejmjd-1.2
Worm BaseAllele Name tm3713
CGC Name jmjd-1.2
Sequence F29B9.2
Phenotypehomozygous viable. Dr. A. Salcini: Mol Cell. 38, 165 (2010).
Mutation site15767/15768-16342/16343 (575 bp deletion)
ChromosomeIV
Putative gene structurejoin(15142..15324, 15372..15443, 15490..15528, 15586..15774, 15939..16341, 16396..16522, 16881..17201, 17254..17485, 17804..18176, 18231..18968, 19019..19074)
Map position0.59
Balancer
Map position of balancer
Sequence of primersExtFwd:CACATCTCCTCGAGGCTTAC,IntFwd:ATCAGCATTCCGACCATAAG,ExtRev:CCTTACGGTGAGGGAACAGT,IntRev:GAGATGCTTCTCGTTCGGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lin H, Wang Y, Wang Y, Tian F, Pu P, Yu Y, Mao H, Yang Y, Wang P, Hu L, Lin Y, Liu Y, Xu Y, Chen CD.
Coordinated regulation of active and repressive histone methylations by a dual-specificity histone demethylase ceKDM7A from Caenorhabditis elegans.
Cell Res. 2010 20(8) 899-907 
[ PubMed ID = 20567262 ] [ RRC reference ]

Riveiro AR, Mariani L, Malmberg E, Amendola PG, Peltonen J, Wong G, Salcini AE.
JMJD-1.2/PHF8 controls axon guidance by regulating Hedgehog-like signaling.
Development 2017 144(5) 856-865 
[ PubMed ID = 28126843 ] [ RRC reference ]

Myers TR, Amendola PG, Lussi YC, Salcini AE.
JMJD-1.2 controls multiple histone post-translational modifications in germ cells and protects the genome from replication stress.
Sci Rep 2018 8(1) 3765 
[ PubMed ID = 29491442 ] [ RRC reference ]

Kleine-Kohlbrecher D, Christensen J, Vandamme J, Abarrategui I, Bak M, Tommerup N, Shi X, Gozani O, Rappsilber J, Salcini AE, Helin K.
A functional link between the histone demethylase PHF8 and the transcription factor ZNF711 in X-linked mental retardation.
Mol. Cell 2010 38(2) 165-78 
[ PubMed ID = 20346720 ] [ RRC reference ]

Vandamme J, Sidoli S, Mariani L, Friis C, Christensen J, Helin K, Jensen ON, Salcini AE.
H3K23me2 is a new heterochromatic mark in Caenorhabditis elegans.
Nucleic Acids Res. 2015 43(20) 9694-710 
[ PubMed ID = 26476455 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristiz√°bal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colai√°covo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]