Mutants (Isolated)

tm3711

Allele Nametm3711
Sequence NameY48G9A.14
CGC Namemir-65
Worm BaseAllele Name tm3711
CGC Name mir-65
Sequence Y48G9A.14
Phenotypehomozygous viable.
Mutation site93016/93017-93166/93167 (150 bp deletion)
ChromosomeIII
Putative gene structure93151..93170
Map position-14.93
Balancer
Map position of balancer
Sequence of primersExtFwd:ACGAGAAAGGTATCGGGTGT,IntFwd:GCGTGATCATCTTCCTCAAG,ExtRev:CGCCATGTTTGACACCGTTA,IntRev:GCACTGCGCGTAGCAGAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Asikainen S, Rudgalvyte M, Heikkinen L, Louhiranta K, Lakso M, Wong G, Nass R.
Global microRNA expression profiling of Caenorhabditis elegans Parkinson's disease models.
J Mol Neurosci 2010 41(1) 210-8 
[ PubMed ID = 20091141 ] [ RRC reference ]