Mutants (Isolated)

tm370

Allele Nametm370
Sequence NameY119D3B.15
CGC Namedss-1
Worm BaseAllele Name tm370
CGC Name dss-1
Sequence Y119D3B.15
Phenotypelethal or sterile
Mutation site16200/16201-17666/17667 (1466 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(17015..17152, 18513..18623))
Map position-24.87
Balancerdpy-1 (e1) III
Map position of balancer-19.35
Sequence of primersExtFwd:TCAGCCTATTTCCAGTCGAA,IntFwd:ATCTACCGCCGCCAAAAAAG,ExtRev:GCAGCAGACGGAGCATATAT,IntRev:TGTGTGTGTAGGAATTGCGC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Pispa J, Palmén S, Holmberg CI, Jäntti J.
C. elegans dss-1 is functionally conserved and required for oogenesis and larval growth.
BMC Dev. Biol. 2008 8 51 
[ PubMed ID = 18471277 ] [ RRC reference ]